DNA sequencing

The term DNA sequencing encompasses biochemical methods for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thymine, in a DNA oligonucleotide. The sequence of DNA constitutes the heritable genetic information in nuclei, plasmids, mitochondria, and chloroplasts that forms the basis for the developmental programs of all living organisms. Determining the DNA sequence is therefore useful in basic research studying fundamental biological processes, as well as in applied fields such as diagnostic or forensic research. The advent of DNA sequencing has significantly accelerated biological research and discovery. The rapid speed of sequencing attainable with modern DNA sequencing technology has been instrumental in the large-scale sequencing of the human genome, in the Human Genome Project. Related projects, often by scientific collaboration across continents, have generated the complete DNA sequences of many animal, plant, and microbial genomes.
See more at Wikipedia.org...

Le séquençage de l'ADN consiste à déterminer l'ordre d'enchaînement des nucléotides d’un fragment d’ADN donné. Actuellement, la plupart des séquençages d’ADN sont réalisés par la méthode de Sanger décrite ci-dessous. Cette technique utilise la réaction de polymérisation de l’ADN à l'aide d'une ADN polymérase  et des didésoxyribonucléotides (ddNTP).
Pour la suite, voir Wikipédia.org…

DNA-Sequenzierung ist die Bestimmung der DNA-Sequenz, d.h. der Nukleotid-Abfolge in einem DNA-Molekül. Die DNA-Sequenzierung hat die biologischen Wissenschaften revolutioniert und die Ära der Genomforschung (Genomik) eingeleitet. Seit 1995 konnte durch DNA-Sequenzierung das Genom von über 330 verschiedenen Organismen analysiert werden (siehe Sequenzierte Organismen).
Mehr unter Wikipedia.org...

Sekwencjonowanie DNA - technika odczytywania sekwencji czyli kolejności par nukleotydowych, w cząsteczce DNA. Sekwencjonowanie dokonuje się przy pomocy zautomatyzowanych sekwencjonerów. Manualne sekwencjonowanie stosuje się przy opracowywaniu nowatorskich metod, w niektórych laboratoriach dla krótkich fragmentów, lub podczas ćwiczeń .Przykład sekwencji DNA (początek operonu laktozowege E. coli z GenBank) GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG gdzie: A - adenina; C - cytozyna; G - guanina; T - tymina
W celu uzyskania więcej informacji, zobacz w Wikipedia.οrg...

Sequencing is het bepalen van de nucleïnezuur- of aminozuur-sequentie van een DNA/RNA respectievelijk eiwit.
Zie meer op Wikipedia.org...